Ke hadapan Faruq disodorkan urutan DNA sebagai berikut : ATGGAGGGCGGGCTGGGGCGTGCTGTGTGCTTGCTGACCGGGG CCTCCCGCGGCTTCGGCCGGACGCTGGCCCCGCTCCTGGCCTCG CTGCTGTCGCCCGGCTCCGTGCTTGTCCTTAGCGCCCGCAACGA CGAGGCACT…., sejurus kemudian Faruq telah selesai menerjemahkan ke dalam urutan asam aminonya : metionin, glutamat, glisin,…dan hasil bacaannya segera dikirim balik kepada pemesannya beserta tagihan bayarannya. Faruq pun bersorak dan puas dengan hasil kerjanya.

Rangkaian peristiwa tersebut tidaklah terjadi di laboratorium canggih, atau di perusahaan bioteknologi dan Faruq pun bukan seorang profesor pakar genetika ataupun analis laboratorium bioteknologi tapi itu merupakan suasana ruang bermain di sebuah sekolah dasar. Faruq adalah salah seorang murid kelas 1 disekolah tersebut.

Mereka sedang bermain dadu dan piramida kode genetika, suatu kode yang sangat penting dalam bioteknologi. Permainan ini tentu adalah permainan yang sangat mudah dilakukan. Alat yang digunakan pun sangat sederhana dan bisa dibuat sendiri dengan bahan yang mudah didapatkan di sekitar kita.

Mengenal Kode Genetika
Kode genetika, kode yang dibuat untuk menandai informasi genetik yang dibawa oleh DNA kita, dituliskan dalam untaian huruf yang disusun oleh 4 macam basa nukleotida A (Adenin), G (Guanin), C ((C)sitosin)  dan T (Timin). Setiap 3 huruf  yang berurutan menyandi satu macam asam amino tertentu dan disebut dengan kodon.

Pengunaan kode ini berkembang ketika ilmuwan dari lembaga penelitian NIH (National institutes of health) yang bernama Marshall Nirenberg dan rekannya Heinrich J. Matthaei pada tahun 1961 menemukan untuk pertama kalinya kodon ini. Karena kodon disusun dengan variasi 4 huruf dengan susunan 3 huruf berurutan maka dengan perhitungan matematika didapatkan 4x4x4 =64 macam kemungkinan kombinasi huruf-huruf dari basa nukleotida yang menyusun kodon tersebut dan inilah yang disebut dengan standar kode genetika yang menyandi asam amino penyusun protein tertentu secara spesifik.

Terdapat 20 macam asam amino standar yang digunakan untuk menyusun protein di dalam tubuh kita. Penulisan nama asam amino di dalam biokimia bisa dituliskan lengkap namanya seperti metionin, prolin, dituliskan dalam lambang tiga huruf seperti Met, Pro atau bisa juga ditulis dalam lambang satu huruf seperti M untuk metionin dan P untuk prolin.

Tiap-tiap asam amino memiliki karakter spesifik baik struktur, berat molekul, titik isoelektrik maupun muatannya. Karena jumlah variasi kodon ada 64 sedang asam amino yang disandi hanya 20 kalau ditambah dengan stop kodon menjadi 23 maka satu jenis asam amino bisa disandi oleh lebih dari satu urutan kodon, variasi ini umumnya terdapat pada nukleotida ketiga dari setiap kodonnya, kondisi ini justru malah menguntungkan, karena bila terjadi mutasi pada nukleotida ketiga bisa jadi tidak merubah jenis asam amino yang disandi dan hasil akhirnya protein tidak berubah dan tidak terjadi kelainan, kondisi seperti ini yang dikenal dengan istilah mutasi tersamarkan (silent mutation).

Permainan dadu dan piramida kode genetika dirancang didasarkan pada penyandian 20 macam asam amino oleh oleh 64 macam kodon . Dengan menggunakan dadu dan piramida yang dirancang secara khusus ini  maka kita bisa bermain dan menerjamahkan kode genetika yang terdapat dalam urutan DNA menjadi urutan asam amino yang menyusun struktur protein dengan mudah, cepat dan tentu mengasikkan.

Cara Pembuatan Piramida dan Dadu Kode Genetika
Alat dan bahan
- kertas karton atau manila warna putih (atau warna lain tergantung selera kita, pilih kertas dengan ketebalan tertentu sehingga mudah dibentuk dan cukup kuat)
- spidol  atau alat tulis berwarna lainnya (minimal ada 4 macam warna)
- gunting (atau alat pemotong lain) dan alat perekat (lem, selotip dll)
- pengaris

Cara pembuatan
a. buatlah sebuah dadu (bentuk kubus) dari kertas putih  atau kertas berwarna, warnai pada masing masing sisi dadu dengan warna yang berbeda dan di keempat sisinya tuliskan masing masing huruf A, G, C dan T, ukuran dadu, variasi warna dan ukuran huruf  dibuat sedemikian rupa sehingga mudah dibaca. Pada dua sisi lainnya (sisi atas dan bawah dadu ) gambari dengan gambar yang sederhana dan menarik seperti bulan, bintang, atau gambar bulatan wajah tersenyum.

b. Buatlah sebuah piramida kertas dengan ukuran bebas tapi memungkinkan untuk dibubuhi tulisan kode kode nukleotida dan asam amino. Pada keempat sisi piramida tersebut tuliskan kode genetika dan sesuaikan warna dengan warna yang adan di dadu (lihat gambar ).

c. pada bagian alas piramida tuliskan pertanyaan sederhana mengenahi kode genetika seperti : 1. Apa arti A?
2. Apa arti G?
3. Apa arti T?
4. Apa arti C?

d. Siapkan urutan DNA tertentu untuk bermain tingkat lanjut (menerjemahkan hasil sekuen DNA)

Cara bermain
1. Siapkan dadu dan piramida kode genetika.

2. Siapkan hadiah sederhana

3. Bila memungkinkan bentuk kelompok anak yang terdiri dari 3-4 orang (satu orang bertindak sebagai pelempar dadu, satu orang sebagai professor penentu asam amino dan lainnya adalah pencatat hasil bacaan.

4.  Lemparkan dadu kode genetika secara acak dan bacalah huruf apa yang berada disisi atas, kenali huruf dan warnanya , kemudian putar piramida sehingga huruf dan warna yang sesuai dengan mata dadu yang berada diatas menghadap kepada penentu asam amino, petugas mencata mencatat hasil lemparan dadu pertama (misalnya : A).

5. Lemparkan kembali dadu dan pastikan mata dadu dengan huruf dan warna apa yang ada di bagian atas , penentu asam amino kemudian mencari huruf tersebut didalam baris ke dua didalam sisi A tsersebut dan petugas pencata menuliskan nukleotida kedua yang berhasil di temukan (misalnya: T).

6. Lemparkan kembali dadu dan dengan cara yang sama tentukan huruf ke tiga dibawah kotak T baris kedua (misalnya: G).

7. Professor penentu asam amino kemudian mengecek pada kotak berikutnya di piramida kode genetika pada sisi A, kotak kedua T dan  dibawah kotak G untuk memastikan ATG adalah kode untuk asam amino apa , temukan lanbang satu huruf, lambing 3 huruf dan asam amino terjemahannya (M/met/metionin). Pencatat menulis dengan lengkap .

8. Selesailah satu tahap pembacaan satu asam amino dan ulangi terus sebanyak yang anda kehendaki, bila ada lebih dari satu kelompok buatlah perlombaan, dalam 30 menit ada berapa asam amino yang berhasil di baca, berikan hadiah kepada pemenangnya.

9. Bila pada suatu lemparan teryata mata dadu yang bergambar (bukan huruf) yang berada diatas maka , baliklah piramida kode genetika sehingga pertanyaan yang ada dibagian alas bisa terbaca dengan mudah, jawablah pertanyaan yang ada dan berikan hadiah bila mampu menjawab dengan benar.

10. Setelah bermain berulang ulang, cobalah untuk menerjemahkan urutan sekuen DNA yang ada dengan melacak masing masing kodon yang tertulis, pastikan bahwa masing masing anak mengambil bagian dalam proses ini, apapun perannya.

11. sekarang kehadapan anda disodorkan hasil bacaan DNA suatu enzim yang berperan dalam kejadian penyakit Alzaimer’s berikut :
“ATGAAACATATACTCCTGATCACCGGCGCAGGAAAAGGCATTGGCCGCGCTAT CGCGCTCGAATTTGCCCGAGCCGCCAGACACCATCCCGACTTCGAACCGGTGCTCG TGCTCTCTTCGCGCACAGCGGCAGACCTCGAAAAAATCTCTCTTGAATGCCGTGCC GAAGGTGCCCTGACCGACACCATCACCGCTGATATCTCCGATATGGCTGATGTAAG GAGGTTAACCACACACATTGTTGAGCGCTATGGTCACATCGATTGTCTGGTGAACA ACGCCGGGGTTGGCCGTTTCGGAGCACTGAGCGATCTGACCGAAGAGGATTTCGACT ATACCATGAACACAAA… dalam waktu 10 menit sudahkan tersusun asam amino yang disandinya?

Gampang dan mengasikkan bukan? Selamat mencoba dan kalau kita bisa mengenalkan  bioteknologi sejak dini kenapa tidak kita coba dari sekarang ?

Di bawah ini gambar sisi-sisi dari piramida kode genetika, warna disesuaikan dengan warna dadu yang dipilih : 

Pencarian artikel ini: